View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_189 (Length: 250)
Name: NF8548A_low_189
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_189 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 27430654 - 27430421
Alignment:
| Q |
13 |
agatggacatcaatggagaaagtatgggcnnnnnnngatcttgcacaccgattttccaaggnnnnnnnnnnnnnnnttttacgagtttaattaagcacta |
112 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
27430654 |
agatggtcatcaatggagaaagtatgggcaaaaaaagatcttgcacaccgattttccaaggtatatatat------ttttacgagtttaattaagcacaa |
27430561 |
T |
|
| Q |
113 |
acttcactatttgaacacattatcatgttaattattgattttcaaattaattaattttcactatgggaatatatatttattt--atatgctttgcaggaa |
210 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27430560 |
acttcactatttgaacaaattatcatgttaattattgattttcaaattaattaattttcactatgggaatatatatttatttatatatgctttgcaggaa |
27430461 |
T |
|
| Q |
211 |
ctattacaggtgcactcacaaacatgatcaaggttgcaaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430460 |
ctattacaggtgcactcacaaacatgatcaaggttgcaaa |
27430421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 201 - 250
Target Start/End: Complemental strand, 27447717 - 27447668
Alignment:
| Q |
201 |
tttgcaggaactattacaggtgcactcacaaacatgatcaaggttgcaaa |
250 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
27447717 |
tttgcaggaactattacagatgcactcacaaaaatgatcaaggttgcaaa |
27447668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University