View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_193 (Length: 249)
Name: NF8548A_low_193
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_193 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 27491921 - 27492130
Alignment:
| Q |
17 |
agaatatgagcatgtgtgtgtttggttatgtatgtgacacaaaccaannnnnnnaatgaattcattttgtaaaattggttgtgcttaaagtgatgtgtgc |
116 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27491921 |
agaaaatgagcatgtgtgtgtttggt-atgtatgtgacacaaaccaatttttttaatgaattcattttgtaaaattggttgtgcttaaagtgatgtgtgc |
27492019 |
T |
|
| Q |
117 |
ttcattttctagtgataataaatgttttgagtgaattaactttttgaaattgagtaccattaaaaat-aattgaatataaagtgatttatattttaatgt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||| ||||||||||| ||||||||| |
|
|
| T |
27492020 |
ttcattttctagtgataataaatgttttgagtgaattaactttttgaaattgagtacgattaaaaatgaatttaatatgaagtgatttatgttttaatgt |
27492119 |
T |
|
| Q |
216 |
gtgatatttat |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
27492120 |
gtgatatttat |
27492130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University