View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_198 (Length: 249)
Name: NF8548A_low_198
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_198 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 11 - 249
Target Start/End: Original strand, 30841247 - 30841486
Alignment:
| Q |
11 |
tgagatggacatcacatctttacccaaaaccttnnnnnnntaggtttatgagtaatcttatttataagtgctctaccttcacttttctaagtaatgt-at |
109 |
Q |
| |
|
|||| |||||| | ||||||||||||||||||| ||||||||||||| |||||||||||||||| || ||||||||||||||||||||||| || |
|
|
| T |
30841247 |
tgagttggacaccgcatctttacccaaaaccttaaaaaaataggtttatgagtcatcttatttataagtgttcaaccttcacttttctaagtaatgttat |
30841346 |
T |
 |
| Q |
110 |
actcctaagtctaactcatacttgcaacttccaactcacgcttgttacacaacaatcttctctccaggtgtgagctcatcaattcatcataccccccgtc |
209 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30841347 |
acttctaagtctaactcatacttgcaacttccaactcacggttgttacactacaatcttctctccaggtgtaagctcatcaattcatcataccccccgtc |
30841446 |
T |
 |
| Q |
210 |
aaacataaactttttcatccacttacacttacttgcaccg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30841447 |
aaacataaactttttcatccacttacacttacttgcaccg |
30841486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University