View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_203 (Length: 249)
Name: NF8548A_low_203
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_203 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 51 - 249
Target Start/End: Original strand, 22337632 - 22337831
Alignment:
| Q |
51 |
tctagcatttaaaagtctgtgataaaactatgttcatgttaaaaatcaacttgacaatagtggggagtttattactttaacatgctaaagaccacctaat |
150 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22337632 |
tctagcatttaaaagtctctgataaaactatgttcatgttaaaaatcaacttgacaatagtggggagtttattactttaacatgctaaagaccacctaat |
22337731 |
T |
 |
| Q |
151 |
ataagatattatctttgaaaaa-ttgatttactcttttgtaatagtcaaggccatggaatttactattacctctaattcaagttcatagctacgttgatg |
249 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
22337732 |
ataacatattatctttgaaaaatttgatttactcttttgtaatagtcaaggccatggaatttactattacctctgatacaagttcatagctacgtagatg |
22337831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University