View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_247 (Length: 239)
Name: NF8548A_low_247
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_247 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 4 - 239
Target Start/End: Original strand, 51295450 - 51295670
Alignment:
| Q |
4 |
ttaacgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaaagagatgccataagtatatgtgtttttctcatttcaccctttcatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
51295450 |
ttaacgatctcttttatctaaagtaggtatcaacacaccaaacgaaaatcttaaagagatgccataagtatatgggtttttctcatttcaccctttcacg |
51295549 |
T |
 |
| Q |
104 |
ccaaacattattgagtttgatcatgtgtcacttattgtgagatagaggggtgaacttctatatttggtcttacttgtcataattgattattctatatcat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51295550 |
ccaaacattattgagtttgatcatgtgtcac---------------ggggtgaacttctatatttggtcttacttgtcataattgattattctatatcat |
51295634 |
T |
 |
| Q |
204 |
attaatttttcatattagaattgatgtgtggatatt |
239 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51295635 |
attaattttttatattagaattgatgtgtggatatt |
51295670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University