View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_254 (Length: 236)
Name: NF8548A_low_254
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_254 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 23 - 215
Target Start/End: Original strand, 11821836 - 11822028
Alignment:
| Q |
23 |
aaaaagatgattgagttgggaaaagttggatttgttttcaacccttatggtggaaaaatggctcagattccggccgatgcaacgccatttcctcaccgtg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11821836 |
aaaaagatgattgagttgggaaaagttggatttgttttcaacccttatggtggaaaaatggctgagattccggccgatgcaacgccatttcctcaccgtg |
11821935 |
T |
|
| Q |
123 |
ccggaaatttgttcaaaattcaattctcagtgaattggaatgatccagcacctaatgcaacagttggttttttgaatcaagctaaggtacttt |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11821936 |
ccgggaatttgttcaaaattcaattctcagtgaattggaatgatccagcacctaatgcaacagttggttttttgaatcaagctaaggtacttt |
11822028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 11834528 - 11834337
Alignment:
| Q |
23 |
aaaaagatgattgagttgggaaaagttggatttgttttcaacccttatggtggaaaaatggctcagattccggccgatgcaacgccatttcctcaccgtg |
122 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11834528 |
aaaaagatgattgagttaggaaaaattggatttgttttcaacccttatggtggaaaaatcgctgagattccggccgatgcaacgccatttcctcaccgtg |
11834429 |
T |
|
| Q |
123 |
ccggaaatttgttcaaaattcaattctcagtgaattggaatgatccagcacctaatgcaacagttggttttttgaatcaagctaaggtactt |
214 |
Q |
| |
|
| |||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11834428 |
ctggaaatttgttcaaaattcaatattcagtgaattgggatgatccatcacctaatgcaacagttggttttttgaatcaagctaaggtactt |
11834337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 83
Target Start/End: Original strand, 11918181 - 11918241
Alignment:
| Q |
23 |
aaaaagatgattgagttgggaaaagttggatttgttttcaacccttatggtggaaaaatgg |
83 |
Q |
| |
|
||||||||||| ||||||| ||||| || | | ||||||| ||||||||||||||||||| |
|
|
| T |
11918181 |
aaaaagatgatcgagttggaaaaaggtgtaatgtttttcaatccttatggtggaaaaatgg |
11918241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 38126155 - 38126207
Alignment:
| Q |
30 |
tgattgagttgggaaaagttggatttgttttcaacccttatggtggaaaaatg |
82 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||||||||| |||||||||||| |
|
|
| T |
38126155 |
tgattgaattgggaaaagtaggattgactttcaacccttacggtggaaaaatg |
38126207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University