View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_258 (Length: 235)
Name: NF8548A_low_258
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_258 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 15 - 202
Target Start/End: Complemental strand, 3429499 - 3429312
Alignment:
| Q |
15 |
gaagacaaaatgaggactatacccaccacaatgctaaacccaccccccaacaacacccccacaactattactccctccttatggcacactccaatcccat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429499 |
gaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactccaatcccat |
3429400 |
T |
|
| Q |
115 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429399 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaa |
3429312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 15 - 200
Target Start/End: Complemental strand, 3426020 - 3425835
Alignment:
| Q |
15 |
gaagacaaaatgaggactatacccaccacaatgctaaacccaccccccaacaacacccccacaactattactccctccttatggcacactccaatcccat |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||| | |||||||| ||| ||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
3426020 |
gaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgccat |
3425921 |
T |
|
| Q |
115 |
atctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaagg |
200 |
Q |
| |
|
||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |
|
|
| T |
3425920 |
atctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagg |
3425835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University