View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_272 (Length: 230)
Name: NF8548A_low_272
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_272 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 40809993 - 40810217
Alignment:
| Q |
6 |
agtttaattgtaagggattttaattgagcgaaggttagtgtttgagaagaatcggcatctataagagcggttttgtttggggaagaagtgactttgttga |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809993 |
agtttaattgtaagggattttaattgagcgaaggttagtgtttgagaagaatcggcatctataagagcggttttgtttggggaagaagtgactttgttga |
40810092 |
T |
|
| Q |
106 |
agaggtgtgttacgagagagaggtttggattttttggtaagataagggaaggtcttaaggacctgtatattccatctgaaccgtaacctgatttctgcat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40810093 |
agaggtgtgttacgagagagaggtttggattttttggtaagataagggaaggtcttaaggacctgtatattccatctgaaccgtaacctgatttctgcat |
40810192 |
T |
|
| Q |
206 |
tggaaaagtacttttttgaaaatcg |
230 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
40810193 |
tggaaaagtacttttttgaaaatcg |
40810217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University