View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_273 (Length: 230)
Name: NF8548A_low_273
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_273 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40606119 - 40605897
Alignment:
| Q |
1 |
tacatatacagggcctggttgtgcagctgagttagaatagaatagcttgcaagttgcaataggccgtagggagtatatgccccagatttgttggcgaata |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40606119 |
tacaaatacagggcctggttgtgcagctgagttagaatagaatagcttgcaagttgcaataggccgtagggagtat-tgccccagatttgttggcgaata |
40606021 |
T |
|
| Q |
101 |
ttggttccaataataatatatacaactgcacttggttgttgtgacttgtgagggagtttaaatgcacagaacctcaagaattcatttgttctttcaaaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606020 |
ttggttccaataataatatatacaactgcacttggttgttgggacttgtgagggagtttaaatgcacagaacctcaagaattcatttgttctttcaaaat |
40605921 |
T |
|
| Q |
201 |
atggtaatattatcatgtaaattt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
40605920 |
atggtaatattatcatgtaaattt |
40605897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University