View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_287 (Length: 229)
Name: NF8548A_low_287
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_287 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 12843832 - 12844054
Alignment:
| Q |
1 |
aatccaacgaaggtgttcttaggatgacggagaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12843832 |
aatccaacgaaggtgttcttaggatgacggagaaagttgcagagactaaccggaatcatatcggcgagagagaggtggaagataagacagctgccactga |
12843931 |
T |
 |
| Q |
101 |
tgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccattgaacgccaaggccgacaacgagattacggttacggagattacggttgcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
12843932 |
tgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccattgaacgccaaggccgacaatgagattacggttacagagattacggttgcg |
12844031 |
T |
 |
| Q |
201 |
gcgaaggtattgaaggtggcgga |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12844032 |
gcgaaggtattgaaggtggcgga |
12844054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 12861649 - 12861462
Alignment:
| Q |
1 |
aatccaacgaaggtgttcttaggatgacggagaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccactga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
12861649 |
aatccaacgaaggtgttcttaggatgacggagaaaattgcagagactgaccggaatcatatctgcgcgagagaggtggaagataagacagctgccaccga |
12861550 |
T |
 |
| Q |
101 |
tgcataactgtagcgtgtcggcgggaggatcaaggttgccgggagtccattgaacgccaaggccgacaacgagattacggttacggag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||| ||||||| ||| ||||| |
|
|
| T |
12861549 |
tgcataactgtagcgtgtcggcgggaggatcaaggttgcggttagtccattgaacgccgaggccgacaacaagattacagttgcggag |
12861462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University