View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_300 (Length: 228)
Name: NF8548A_low_300
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_300 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 31097632 - 31097404
Alignment:
| Q |
1 |
gtgaggtggctggtctaatagtaatgatattttcatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgatgaagnn |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31097632 |
gtgaggtggctggtttaatagtaatgatatttttatcaagtcagtttttatatcaagatttaattaacaatcagtttgatatttttaaattgataaagtt |
31097533 |
T |
 |
| Q |
101 |
nnnnn-acttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097532 |
ttttttacttattctcaatctttatccctttagagttctatatactgatcaaaggtagcaagaattcaaccgatcaacaattacctacacaagactaatc |
31097433 |
T |
 |
| Q |
200 |
atgatcagttgattgtgtggaactaatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31097432 |
atgatcagttgattgtgtggaactaatga |
31097404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University