View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_303 (Length: 227)
Name: NF8548A_low_303
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_303 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 31 - 210
Target Start/End: Complemental strand, 43098995 - 43098816
Alignment:
| Q |
31 |
tatactaatgtaagtgtcatcaaatggtgagctagacctgacatacaagttttagacagtagtactatatgattttgcattttgcaagctgctgttagtc |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43098995 |
tatactaatgtaagtgtcatcaaatggtgagctagacctgacatacaagttttagacggtagtactatatgattttgcattttgcaagcagctgttagtc |
43098896 |
T |
 |
| Q |
131 |
tgttacatgttctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43098895 |
tgttacatgttctagttttcgaactttattaaatgctgaccaaacttgtctcttttgcctgacattgttacagctagttt |
43098816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University