View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_310 (Length: 224)
Name: NF8548A_low_310
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_310 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 22362099 - 22362299
Alignment:
| Q |
27 |
cttaatactatggtatattctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaacgcatgaaaaagaaaagatgaataagag |
126 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
22362099 |
cttaatactatggtatactctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaatgcatgaaatagaaaagatgaataagaa |
22362198 |
T |
|
| Q |
127 |
cc---cagcaagatcatggttaaaatatggaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgagcgg |
223 |
Q |
| |
|
|| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362199 |
cccagcagcaatatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgagcgg |
22362298 |
T |
|
| Q |
224 |
a |
224 |
Q |
| |
|
| |
|
|
| T |
22362299 |
a |
22362299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University