View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_311 (Length: 224)
Name: NF8548A_low_311
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_311 |
 |  |
|
| [»] scaffold0035 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 5832045 - 5831861
Alignment:
| Q |
23 |
aaggaagaggtgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5832045 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
5831946 |
T |
 |
| Q |
123 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831945 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttcat |
5831861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 5823994 - 5824161
Alignment:
| Q |
23 |
aaggaagaggtgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgc |
122 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||| | ||||||||| |||||| ||||||| |
|
|
| T |
5823994 |
aaggaagagttgctgataattcaattgggccattagagattcgtgtggtgaaaaatggcacattcgaggatttgatggattattatatatcgtgtggtgc |
5824093 |
T |
 |
| Q |
123 |
aagtatcaatcagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactcta |
190 |
Q |
| |
|
| || ||||| |||||||||||||||||||||||| |||| ||| || |||||||||||||||||| |
|
|
| T |
5824094 |
atcgattaatcaatataaagttcctaggtgcgtgagtctcacacctgtagtggaacttcttgactcta |
5824161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 33 - 206
Target Start/End: Original strand, 78765 - 78938
Alignment:
| Q |
33 |
tgctgataattcaattgggccattagagatttgtgtggtgaaaaatggcacgtttgaggaactaatggattatgcaatatcgcgtggtgcaagtatcaat |
132 |
Q |
| |
|
||||||| |||||||||| ||||| ||||| | || ||||| | ||| || |||||||| || |||||||||||||| || | ||||| || ||| |
|
|
| T |
78765 |
tgctgatcattcaattggaccattggagataagggttgtgaagagtggaacttttgaggagcttatggattatgcaatctcaagaggtgcttcaataaat |
78864 |
T |
 |
| Q |
133 |
cagtataaagttcctaggtgcgtgagtttcactcctataatggaacttcttgactctagggtggtatcagttca |
206 |
Q |
| |
|
|| ||||||||||| ||||| || | ||| |||||||||||||| ||| | |||||||||||||| || ||||| |
|
|
| T |
78865 |
caatataaagttccaaggtgtgttaattttactcctataatggagcttttggactctagggtggtctctgttca |
78938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University