View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_323 (Length: 218)
Name: NF8548A_low_323
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_323 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 50465730 - 50465548
Alignment:
| Q |
17 |
acatcaatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattacta-------attctttttagccattcacaaaca |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50465730 |
acatcgatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattactacttactaattctttttagccattcacaaaca |
50465631 |
T |
|
| Q |
110 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465630 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctct |
50465548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University