View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_325 (Length: 217)
Name: NF8548A_low_325
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_325 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 30 - 197
Target Start/End: Original strand, 41386976 - 41387146
Alignment:
| Q |
30 |
gaaatagatgtaataagtaatggtgagaaaatttaacatgnnnnnnnna---aaattgtttggaattgcacttggcgttgtctttcaatgcagtgagaag |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
41386976 |
gaaatagatgtaataagtaatggtgagaaaatttaagatgttttttttttttaaattgtttggaattgcacttggtgttgtctttcaatgcactgagaag |
41387075 |
T |
|
| Q |
127 |
gaatgtatggtttgtgcagattttgaaagacaatggcagacgcggaggatattcagccactggtctatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
41387076 |
gaatgtatggtttgtgcagattttgaaagacaatggcagacgccgaggatattcagccactggtctgtgat |
41387146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University