View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_326 (Length: 216)
Name: NF8548A_low_326
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_326 |
 | |
|
| [»] scaffold0009 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0009 (Bit Score: 168; Significance: 3e-90; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 24 - 195
Target Start/End: Original strand, 40010 - 40181
Alignment:
| Q |
24 |
tgaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
123 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010 |
tgaagcagcaaaacgacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
40109 |
T |
|
| Q |
124 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgat |
40181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 26 - 146
Target Start/End: Original strand, 33391 - 33511
Alignment:
| Q |
26 |
aagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctcaa |
125 |
Q |
| |
|
|||||||||||| ||| || || ||||||||||||||||||||| || |||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33391 |
aagcagcaaaacgacgtggggtcgaggatctctatctatgcatggtagaagtgaccttgtcgcctaccattttcgtgtgtgaaacacttgtggttctcaa |
33490 |
T |
|
| Q |
126 |
attggatagattaaatgtacc |
146 |
Q |
| |
|
|||||||||| ||| |||||| |
|
|
| T |
33491 |
attggatagaataattgtacc |
33511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 117
Target Start/End: Original strand, 21734 - 21826
Alignment:
| Q |
25 |
gaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtg |
117 |
Q |
| |
|
|||| |||||||| ||| || || ||||||||||||||| | ||||| |||||| ||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
21734 |
gaagaagcaaaacgacgtggggtcgaggatctctatctaaacttgttagaagtgaccttgtcgcctaccattttcgtttgtagaacacttgtg |
21826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 192
Target Start/End: Complemental strand, 19970313 - 19970209
Alignment:
| Q |
88 |
cctaccattttcgtgtgtgaaacacttgtggtcctcaaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaa |
187 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || |||||| ||| || ||||| | |||||| ||| | ||| ||||||||||||||||| |||| |
|
|
| T |
19970313 |
cctaccattttctgctgtgaaacacttgtggttctgaaattgtttagcatacatgtaacaactatgtttcgttcttctgttgatcttccttcgctcaaaa |
19970214 |
T |
|
| Q |
188 |
ccctt |
192 |
Q |
| |
|
||||| |
|
|
| T |
19970213 |
ccctt |
19970209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University