View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_330 (Length: 213)
Name: NF8548A_low_330
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_330 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 40606313 - 40606108
Alignment:
| Q |
8 |
atggtgttaccgtgctactatttattttttcaataaatttaaattactttttataaagccaattcatttcgcattcaaaatcaattattatcacggccgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606313 |
atggtgttaccgtgctactatttattttttcaataaatttaaattactttttataaagccaattcatttcgcattcaaaatcaattattatcacggccgt |
40606214 |
T |
 |
| Q |
108 |
aaaaccaaccacgcatgtaaattagtgagctgccaccagtcaccactcaccaagagctgccgtttggagcaactaaattattgcctttacaatttacata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | |
|
|
| T |
40606213 |
aaaaccaaccacgcatgtaaattagtgagctgccactagtcaccactcaccaagagctgccgtctggagcaagtaaattattgcctttacaatttacaaa |
40606114 |
T |
 |
| Q |
208 |
tacagg |
213 |
Q |
| |
|
|||||| |
|
|
| T |
40606113 |
tacagg |
40606108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University