View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_332 (Length: 213)
Name: NF8548A_low_332
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_332 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 21378359 - 21378531
Alignment:
| Q |
19 |
actatattcactccaagctatcttcagttaacctacctgctatttatggtaaccttattggaactgggaactattttgttgttgtagggcttggtactcc |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21378359 |
actatattcactccaagctatcttcagataacctacctgctatttatggtaaccttattggaacagggaactattttgttgttgtagggcttggtactcc |
21378458 |
T |
|
| Q |
119 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgatcgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21378459 |
taaaaggaacttgtctcttgtttttgatactggtagtgatctcacttggactcagtgtcaaccttgtgctcgt |
21378531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 42 - 186
Target Start/End: Original strand, 21404851 - 21404995
Alignment:
| Q |
42 |
tcagttaacctacctgctatttatggtaaccttattggaactgggaactattttgttgttgtagggcttggtactcctaaaaggaacttgtctcttgttt |
141 |
Q |
| |
|
|||| ||||||||| |||| | ||||| |||||||||| | ||||| |||||||||||| |||||||||| |||||||||| | | ||||| ||| ||| |
|
|
| T |
21404851 |
tcagctaacctaccagctaaatctggtagccttattggatcagggaattattttgttgttttagggcttggaactcctaaaaaggatttgtcacttattt |
21404950 |
T |
|
| Q |
142 |
ttgatactggtagtgatctcacttggactcagtgtcaaccttgtg |
186 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21404951 |
ttgacactggtagtgatctcacttggactcaatgtcaaccttgtg |
21404995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University