View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_336 (Length: 211)
Name: NF8548A_low_336
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_336 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 26 - 211
Target Start/End: Original strand, 34683208 - 34683393
Alignment:
| Q |
26 |
gacatcatgaagattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683208 |
gacatcatgaagattatgagcagaacctctataaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaat |
34683307 |
T |
|
| Q |
126 |
caaacaaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34683308 |
caaacaaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacacaa |
34683393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 29 - 210
Target Start/End: Original strand, 34699430 - 34699611
Alignment:
| Q |
29 |
atcatgaagattatgagcagaacctctatgaaagtgggagacaactctgcaaatgtcctaagagagttggcaagtacaataaagaaaatgaaaaaatcaa |
128 |
Q |
| |
|
|||| |||||||||||||| ||| || ||||||||||||| ||||||||| | |||| |||||||| | ||| |||||| || || |||| ||| |||| |
|
|
| T |
34699430 |
atcaagaagattatgagcacaacatcaatgaaagtgggagccaactctgcgagtgtcttaagagagctatcaattacaatcaataatatgacaaagtcaa |
34699529 |
T |
|
| Q |
129 |
acaaacttgatattctagtcatagagatgaataatgcagccctagagcttcagaatttattaaaatcttatccaaacacaca |
210 |
Q |
| |
|
| |||||||||| | | |||| ||||||||||| ||| | | |||||| || |||||||||||||| ||| |||||||||| |
|
|
| T |
34699530 |
agaaacttgatagtttggtcaaagagatgaatattgctacacaagagctacaaaatttattaaaatcatattcaaacacaca |
34699611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University