View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548A_low_349 (Length: 205)
Name: NF8548A_low_349
Description: NF8548A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548A_low_349 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 15 - 205
Target Start/End: Original strand, 31556849 - 31557039
Alignment:
| Q |
15 |
atggacatcttacaagtcaatgacatttactcaatgtgtaagcatataacacagacttaatttatatgcagtgacaccacacttttaatcaatcataacc |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556849 |
atggacagattacaagtcaatgacatttactcaatgtgtaagcatataacacagacttaatttatatgcagtgacaccacacttttaatcaatcataacc |
31556948 |
T |
 |
| Q |
115 |
gattgggctatgcaggttgtgaatgagaccttaagggttgcaaacataattggtgccatatttaggagaacaaccacagacatcgacataa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31556949 |
gattgggctatgcaggttgtgaatgagaccttaagggttgcaaacataattggtgccatatttaggagaacaaccacagacatcgacataa |
31557039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 198
Target Start/End: Original strand, 35478767 - 35478843
Alignment:
| Q |
122 |
ctatgcaggttgtgaatgagaccttaagggttgcaaacataattggtgccatatttaggagaacaaccacagacatc |
198 |
Q |
| |
|
||||| |||||||||||||||| |||||| | |||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
35478767 |
ctatgtaggttgtgaatgagactttaaggatggcaaacataattggtgggatatttaggagagcaatgacagacatc |
35478843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 56
Target Start/End: Original strand, 35478626 - 35478658
Alignment:
| Q |
24 |
ttacaagtcaatgacatttactcaatgtgtaag |
56 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35478626 |
ttacaagtcaatggcatttactcaatgtgtaag |
35478658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University