View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_high_5 (Length: 341)
Name: NF8548_high_5
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 29607206 - 29606868
Alignment:
| Q |
1 |
atcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607206 |
atcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttacta |
29607107 |
T |
 |
| Q |
101 |
tgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ggtgtgtctattgcag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29607106 |
tgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctattgcag |
29607007 |
T |
 |
| Q |
189 |
gtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607006 |
gtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttc |
29606907 |
T |
 |
| Q |
289 |
tttgtctggtgcgggtgctggtgctttcttttcgtgtgt |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29606906 |
tttgtctggtgcgggtgctggtgctttctttttgtgtgt |
29606868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 254 - 307
Target Start/End: Complemental strand, 29606881 - 29606828
Alignment:
| Q |
254 |
ttctttttgtgtgtaggtgctggtgccggtgtttctttgtctggtgcgggtgct |
307 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| | ||||| |||||| |
|
|
| T |
29606881 |
ttctttttgtgtgtaggtgctggtgctggtgcttctttggccggtgctggtgct |
29606828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University