View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_high_7 (Length: 320)
Name: NF8548_high_7
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 29607206 - 29606892
Alignment:
| Q |
1 |
atcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607206 |
atcagccagtggtgctgggggactcctcctaatgattgttgaacttgaacttgtaggctctggtgctagagctagtgcgtgatgtttcttatgcttacta |
29607107 |
T |
|
| Q |
101 |
tgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgct------------ggtgtgtctattgcag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29607106 |
tgcttgtgttttcttctcttgtgcttgtggggtggcggtggttctggcgcatcatcttcaggcgatggtgctggtgctgatgatggtgtgtctattgcag |
29607007 |
T |
|
| Q |
189 |
gtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29607006 |
gtgttggtgcaggtgatggtgggagaattgctggggaaggaacaggtgatgattttggtgctttcttctttttgtgtgtaggtgctggtgccggtgtttc |
29606907 |
T |
|
| Q |
289 |
tttgtctggcgcggg |
303 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
29606906 |
tttgtctggtgcggg |
29606892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 254 - 292
Target Start/End: Complemental strand, 29606881 - 29606843
Alignment:
| Q |
254 |
ttctttttgtgtgtaggtgctggtgccggtgtttctttg |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
29606881 |
ttctttttgtgtgtaggtgctggtgctggtgcttctttg |
29606843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University