View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_low_18 (Length: 281)
Name: NF8548_low_18
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 44 - 279
Target Start/End: Complemental strand, 8710300 - 8710064
Alignment:
| Q |
44 |
tttgaacaaactatcactaggtttcatccttgtcccaccttgtctcactaggtctcactaaaaaattgtcacaatatagattttgtcattaattttcact |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8710300 |
tttgaacaaactatcactaggtttcatccttggcccaccatgtctcactaggtctcactaaaaaattgtcacaatatagattttgtcattaattttcact |
8710201 |
T |
|
| Q |
144 |
tgtcttcagttttggtctgttagttcgaataattgatgggtgtaggtttctaatttctcgtaaatggattctttattcactttggttattattaaaaatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8710200 |
tgtcttcagttttggtctgttagttcgaataattgatgggtgtaggtttttaatttctcgtaaatggattctttattcactttggttattattaaaaatt |
8710101 |
T |
|
| Q |
244 |
acatgctaccaacaaatact-cctccgtctcaaaata |
279 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||||||| |
|
|
| T |
8710100 |
acatgctactaacaaatactccctacgtctcaaaata |
8710064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University