View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_low_23 (Length: 240)
Name: NF8548_low_23
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_low_23 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 52733882 - 52734092
Alignment:
| Q |
19 |
caagcagcatatctgaaactcatttaatttacgtttccgttcaaatctgaattgatttacgccagctcgctccagatcacaaccgtcaatgctccagttg |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52733882 |
caagcagcatatctgaaactcaattaatttacgtttccgttcaaatctgaattgagttacgccagctcgctccagatcacaaccgtcaatgctccagttg |
52733981 |
T |
|
| Q |
119 |
gactcgatctaggtttctcttctctatactttaatttacnnnnnnngtcggtcaatttccaagatctctctctaacctctgcatacttatcgtaatcaat |
218 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
52733982 |
gactcgatctaggt-----ttctctatactttaattta--atttttgtcggtcaatttccaaga----tctctaacctcttcatacttatcgtaatcaat |
52734070 |
T |
|
| Q |
219 |
ggatctttattttcttattgca |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52734071 |
ggatctttattttcttattgca |
52734092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University