View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_low_29 (Length: 202)
Name: NF8548_low_29
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 91 - 127
Target Start/End: Original strand, 33106842 - 33106878
Alignment:
| Q |
91 |
aaggtcacatggaccaagctacttcacttccgaacaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106842 |
aaggtcacatggaccaagctacttcacttccgaacaa |
33106878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University