View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_low_6 (Length: 445)
Name: NF8548_low_6
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_low_6 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 176 - 445
Target Start/End: Original strand, 33106927 - 33107196
Alignment:
| Q |
176 |
cgccgttcatttcctcgccgatccgaaaaccgacgaggttttcgctaagcttttccttcaaccgttgaatgatttcaccgttaattttccacggattccg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106927 |
cgccgttcatttcctcgccgatccgaaaaccgacgaggttttcgctaagcttttccttcaaccgttgaatgatttcaccgttaattttccacggattccg |
33107026 |
T |
|
| Q |
276 |
gtgattgaagctgacgacggtgagaggatttcttcgtttgcgaagattcttactccgtctgatgcgaacaacggtggtggattttctgttccgaggtttt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107027 |
gtgattgaagctgacgacggtgagaggatttcttcgtttgcgaagattcttactccgtctgatgcgaacaacggtggtggattttctgttccgaggtttt |
33107126 |
T |
|
| Q |
376 |
gtgctgattcgatttttcctccgttggattatagtatggatcctccgttgcagaatctgttgattactga |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33107127 |
gtgctgattcgatttttcctccgttggattatagtatggatcctccgttgcagaatctgttgattactga |
33107196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 91 - 127
Target Start/End: Original strand, 33106842 - 33106878
Alignment:
| Q |
91 |
aaggtcacatggaccaagctacttcacttccgaacaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33106842 |
aaggtcacatggaccaagctacttcacttccgaacaa |
33106878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University