View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8548_low_8 (Length: 403)
Name: NF8548_low_8
Description: NF8548
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8548_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 18 - 391
Target Start/End: Complemental strand, 34872693 - 34872320
Alignment:
| Q |
18 |
aagcttaattattgacatgttttatgtactttatgttcgtaggaaaaatgcagcacattcataagcttgttaagaaatctagcaggaagttggccagccg |
117 |
Q |
| |
|
||||||| ||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34872693 |
aagcttagttactaacatgttttccgtactttatgttcgtaggaaaaatgcagcacattcataagcttgttaagcaatctagcaggaagttggccagccg |
34872594 |
T |
 |
| Q |
118 |
aggcggcggtaggaggatagacatccacaacgtcaacaccatgattgctggggcaggactggactcttcttctcagcaggtagtggaggtggccgatgac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872593 |
aggcggcggtaggaggatagacatccaccacgtcaacaccatgattgctggggcaggactggactcttcttctcagcaggtagtggaggtggccgatgac |
34872494 |
T |
 |
| Q |
218 |
gacaatatggaggtagaggcgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcggt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34872493 |
gacaatatggaggtagaggtgagcaactctctcaaggggaatagggtggagcctgttgacaaagggaagaatgtgcccgtcaaagttgtgcctcttcagt |
34872394 |
T |
 |
| Q |
318 |
ctgagggagaggatctgctccagctgttgaacgtgcggtccgatcctgatcgatatggcccccactcgaccatt |
391 |
Q |
| |
|
|| ||||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872393 |
ctcagggagaggatttgctccaactgttgaacgtgtggtccgatcctgatcgatatggcccccactcgaccatt |
34872320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University