View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8549_high_11 (Length: 300)
Name: NF8549_high_11
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8549_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 41612094 - 41612380
Alignment:
| Q |
1 |
ttgaaatttgaggtataaaggaagcataagagaatgaagagaggataggtttaaaaaagatatccatcctcttttgttaatttattttggaagaagnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41612094 |
ttgaaatttgaggtataaaggaagcataagagaatgaagagaggataggtttaaaaaagatatccatcctcttttgttaatttattttggaagaagaaaa |
41612193 |
T |
 |
| Q |
101 |
nnnnnnnnn-ggtgaaaatggtggggatgatgaattcaagaatgatggaagatgtggttgtaattggagggttgatcggtgtacaatttgtttatgctgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
41612194 |
aaaaaaaaaaggtgaaaatggtggggatgatgaattcaagaatgatggaagatgtggttgtaattggcgggttgattggtgtacaatttgtttatgctgg |
41612293 |
T |
 |
| Q |
200 |
aaatgctatgctcttgaagtatcttatgtctttaggtctccaatcttttaccattgtcatttacacttcttttgctacatttcttct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41612294 |
aaatgctatgctcttgaagtatcttatgtctttaggtctccaatcttttaccattgtcatttacacttcttttgctacatttcttct |
41612380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University