View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8549_high_12 (Length: 250)

Name: NF8549_high_12
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8549_high_12
NF8549_high_12
[»] chr5 (1 HSPs)
chr5 (152-217)||(5004545-5004610)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 217
Target Start/End: Complemental strand, 5004610 - 5004545
Alignment:
152 acaccctaccctagtctttctatcacaccctaaagctatgaacatcttaaacagcccgaccaaatt 217  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||| |||||  |||||||||||    
5004610 acaccctagcctagtctttctatcacaccctaaagctacgaacatctgaaacaatccgaccaaatt 5004545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University