View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8549_low_24 (Length: 239)
Name: NF8549_low_24
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8549_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 46 - 223
Target Start/End: Original strand, 2692694 - 2692871
Alignment:
| Q |
46 |
ctattgcttgttcaaacagccatgtgaatggtcaggttgataaacgtcgtactggaatgctcccgtttgttttttatgatacttttgggtatgtttatct |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2692694 |
ctattgcttgttcaaacagccatgtgaatggtcaggttgataaacgccgtactggaatgctcccgtttgttttttatgatacttttgggtatgtttatct |
2692793 |
T |
 |
| Q |
146 |
ttacttttctaagttttaaataaaattcaaacacaaaaagtgtggtttgatttggtgtgtgattttgcaacaggtttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2692794 |
ttacttttctaagttttaaataaaattcaaacacaaaaagtgtggtttgatttggtgtgtgattttgcaacaggtttg |
2692871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 98 - 157
Target Start/End: Original strand, 2679169 - 2679228
Alignment:
| Q |
98 |
tggaatgctcccgtttgttttttatgatacttttgggtatgtttatctttacttttctaa |
157 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2679169 |
tggaatgctcccatttgcttttcatgatacttttgggtatgtttacatttacttttctaa |
2679228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University