View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8549_low_26 (Length: 230)
Name: NF8549_low_26
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8549_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 7563764 - 7563546
Alignment:
| Q |
1 |
ttttaaactcttgacagctatttcctttccactcggcaacacacccttatggacatagccaaaaccaccttgtcctatcaaatttgaatcaatgaatccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7563764 |
ttttaaactcttgacagctatttcctttccactcggtaacacccccttatggacatagccaaaaccaccttgtcctatcaaatttgaatcaatgaatccg |
7563665 |
T |
 |
| Q |
101 |
tcggttgcagctgccaattcctcataagtgaatgtgcctcctttaagccctaaagcaaggcttggtgagggaggaggaagaggtggtggtccgcccgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7563664 |
tcggttgcagctgccaattcctcataagtgaatgtgcctcctttaagccctaaagcaaggcttggtgagggaggaggaagaggtggtggtccgcccgaat |
7563565 |
T |
 |
| Q |
201 |
aattcgagctcatgtctgt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7563564 |
aattcgagctcatgtctgt |
7563546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 33145811 - 33145888
Alignment:
| Q |
1 |
ttttaaactcttgacagctatttcctttccactcggcaacacacccttatggacatagccaaaaccaccttgtcctat |
78 |
Q |
| |
|
||||||||| || ||||| |||||||||||| | ||||| | |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
33145811 |
ttttaaacttttaacagcaatttcctttccagtaggcaaaattcccttatgaacataaccaaaaccaccttgtcctat |
33145888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University