View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8549_low_27 (Length: 226)
Name: NF8549_low_27
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8549_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 5329862 - 5330082
Alignment:
| Q |
1 |
ccattttcctacactacatttt-ttcatgcattatatggtatgtatgaagctgacacggacataaacattggacgcaatactgacacgtcgataccagta |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5329862 |
ccattttcctacactacatttttttcatgcattatatggtatgtatgaagctgacacggacataaacattggacacaatactgacacgtcgataccagta |
5329961 |
T |
 |
| Q |
100 |
ataggtaatataaataaaagtaattgaatataaccacatcgacatgtgtccgacaccagacacgctttcaatatgaagcatccgtgctatattgatttga |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5329962 |
ataagtaatataaataaaagtaattgaatataaccacaccaacatgtgtccgacaccagacacgctttcaatatgaagcatccgtgctatattgatttga |
5330061 |
T |
 |
| Q |
200 |
agtgtaagcacttactaatct |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5330062 |
agtgtaagcacttactaatct |
5330082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University