View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8549_low_29 (Length: 208)
Name: NF8549_low_29
Description: NF8549
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8549_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 199
Target Start/End: Complemental strand, 30134232 - 30134054
Alignment:
| Q |
21 |
caattaagttggtccctaaatatttgatgcggtgtcaccgtataggttctgaatgtattgaaattacaaaaacatttgagtgtgttttttgttagtaatt |
120 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30134232 |
caattaagttggtccctaaatatgtgattcggtgtcaccgtataggttctgaatgtattgaaattacaaaaacatctgagtgtgttttttgttagtaatt |
30134133 |
T |
 |
| Q |
121 |
tcgtgaactaagctaactgacggaagagacatttgaacaccaaactaattaatggaagatacacttgaacaccaaactc |
199 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30134132 |
ttgtgaactaaactaactgacggaagagacatttgaacaccaaactaattaatggaagatacacttgaagaccaaactc |
30134054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University