View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8550_high_6 (Length: 223)
Name: NF8550_high_6
Description: NF8550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8550_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 8058757 - 8058561
Alignment:
| Q |
18 |
aaatctaacggtctctacaactacaacatcgtgcatcaactcgagcggatccaaattcttcttattggtaatttgtgtcaggaagctaagggaagtacct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058757 |
aaatctaacggtctctacaactacaacatcgtgcatcaactcgagcggatccaaattcttcttattggtaatttgtgtcaggaagctaagggaagtacct |
8058658 |
T |
 |
| Q |
118 |
gtgatgtgcttgaatggtactgttgtagatgacattgatgatggttaatctctctttcatatttcttatcaacaattattgtaatgagagaattatc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058657 |
gtgatgtgcttgaatggtactgttgtagatgacattgatgatggttaacctctctttcatatttcttatcaacaattattgtaatgagagaattatc |
8058561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 117 - 209
Target Start/End: Original strand, 24776995 - 24777082
Alignment:
| Q |
117 |
tgtgatgtgcttgaatggtactgttgtagatgacattgatgatggttaatctctctttcatatttcttatcaacaattattgtaatgagagaa |
209 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||| || || ||| | ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24776995 |
tgtgatgtgcttgaataatactgttgtatatgaaattgattat---tagtctgt--ttcatatttctaatcaacaactattgtaatgagagaa |
24777082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University