View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8550_low_13 (Length: 213)
Name: NF8550_low_13
Description: NF8550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8550_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 23 - 201
Target Start/End: Complemental strand, 37296857 - 37296679
Alignment:
| Q |
23 |
tcatcctgaggaaactataccggcttagacttattatgatgtaactagtagtaaagatcatgtgcaagagtatggaatcatggggaacaaaggcgtgaaa |
122 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
37296857 |
tcatcctggggaaactataccggcttagacttattatgatgtaactagtagtaatgatcatgtgcaagagtatggaatcgtggggaacaaaggcgtaaaa |
37296758 |
T |
 |
| Q |
123 |
tttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttacatggtttgaggtctgtgctc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37296757 |
tttcttcatatgtcatgtcattagcgaaagacttttcttaaaatagatagattggttgcatggtttgaggtctgtgctc |
37296679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University