View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8551_high_12 (Length: 340)

Name: NF8551_high_12
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8551_high_12
NF8551_high_12
[»] chr8 (24 HSPs)
chr8 (13-330)||(39848065-39848382)
chr8 (55-294)||(38632393-38632633)
chr8 (16-309)||(38453873-38454169)
chr8 (209-301)||(38453605-38453697)
chr8 (155-296)||(34544772-34544913)
chr8 (209-309)||(39848639-39848739)
chr8 (209-309)||(34533709-34533809)
chr8 (209-309)||(38632787-38632887)
chr8 (162-309)||(34533847-34533994)
chr8 (214-301)||(34549175-34549262)
chr8 (162-289)||(38633019-38633145)
chr8 (161-289)||(34539030-34539158)
chr8 (212-308)||(34916549-34916645)
chr8 (229-309)||(39848518-39848598)
chr8 (155-289)||(39848723-39848857)
chr8 (209-309)||(34916134-34916234)
chr8 (181-308)||(34916273-34916400)
chr8 (209-308)||(34916411-34916510)
chr8 (209-309)||(38632651-38632751)
chr8 (210-309)||(38632929-38633028)
chr8 (216-309)||(34533571-34533664)
chr8 (267-309)||(34544897-34544939)
chr8 (155-200)||(34916105-34916150)
chr8 (217-285)||(39848368-39848436)
[»] chr4 (3 HSPs)
chr4 (13-309)||(44474168-44474467)
chr4 (162-301)||(44474596-44474735)
chr4 (186-309)||(44474482-44474605)
[»] chr2 (4 HSPs)
chr2 (12-121)||(32716505-32716614)
chr2 (12-121)||(32716712-32716821)
chr2 (12-81)||(32714091-32714160)
chr2 (12-111)||(32717333-32717432)
[»] chr3 (3 HSPs)
chr3 (87-227)||(7046154-7046295)
chr3 (13-75)||(7046868-7046930)
chr3 (236-301)||(7045814-7045879)
[»] chr5 (1 HSPs)
chr5 (12-102)||(2998222-2998312)
[»] chr6 (2 HSPs)
chr6 (15-121)||(14905520-14905626)
chr6 (14-104)||(14904916-14905006)


Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 24)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 13 - 330
Target Start/End: Original strand, 39848065 - 39848382
Alignment:
Q  13 caatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaagtatgagggtgaattctttgggaattg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  39848065 caatatatgtgggtgattgggttgatggagataagacagggaaaggattgttcatacagccatcaggagacaagtatgagggtgaattctttgggaatcg 39848164  T
Q  113 ccgtcatggcaatggcacccaaacttataagaatggaggtagctacattggaaattggaaaaatgataaaaaagatggaagagggattgagactttggct 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39848165 ccgtcatggcaatggcacccaaacttataagaatggaggtagctacgttggaaattggaaaaatgataaaaaagatggaagagggattgagactttggct 39848264  T
Q  213 aatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattggactt 312  Q
    ||||||||||||||| ||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||    
T  39848265 aatggtgatgtttttaatggttgttggtcaaatgactttgtatatggatatggagtttttagatttgcaaatggtgacgtctacactggaaattggactt 39848364  T
Q  313 gtagtgatgtttttgatg 330  Q
    ||||||||||||||||||    
T  39848365 gtagtgatgtttttgatg 39848382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 55 - 294
Target Start/End: Original strand, 38632393 - 38632633
Alignment:
Q  55 aaggactgttcatacagccatcaggagacaagtatgagggtgaattctttgggaattgccgtcatggcaatggcacccaaacttataagaatggaggtag 154  Q
    |||||||||||||| |  |||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||  ||| ||| |||| |    
T  38632393 aaggactgttcatatattcatcaggagacaagtatgagggtgaattctttaggaattgtcgtcatggcaatgacacccaaacttggaaggatgaaggtgg 38632492  T
Q  155 ctacattggaaattggaaaaatgat--aaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttg 252  Q
    | |||||||||||||||||||||||  ||||||||||||| |||||  || ||||||||||||||||||||||| |||| ||||||||||||||   ||     
T  38632493 c-acattggaaattggaaaaatgataaaaaaaagatggaaaagggacagaaactttggctaatggtgatgttttggatgcttgttggtcaaatggacttc 38632591  T
Q  253 tacatggatatggagtttctagatttgcaaatggggacgtct 294  Q
    ||||||||| |||||||| ||||  |||||||||||| ||||    
T  38632592 tacatggatttggagtttttagagctgcaaatggggatgtct 38632633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 16 - 309
Target Start/End: Complemental strand, 38454169 - 38453873
Alignment:
Q  16 tatatgtgggtgattgggttgatggagataagacagggaaaggac---tgttcatacagccatcaggagacaagtatgagggtgaattctttgggaattg 112  Q
    |||||| |||||||||| |||||||||||| | || |||||||||   | ||| |||| |||| ||||   || ||||||||||| |||| |||  ||||    
T  38454169 tatatgagggtgattggattgatggagatatggcaaggaaaggacgattattcttacatccatgaggaccaaattatgagggtgagttctctggagattg 38454070  T
Q  113 ccgtcatggcaatggcacccaaacttataagaatggaggtagctacattggaaattggaaaaatgataaaaaagatggaagagggattgagactttggct 212  Q
    ||||||||| ||||||||||||||||  ||| ||||||||| ||||| ||||||||||||||| ||||||| |||||||||||||| |  || || | ||    
T  38454069 ccgtcatggtaatggcacccaaacttggaaggatggaggtatctacactggaaattggaaaaaagataaaagagatggaagagggactatgagttggcct 38453970  T
Q  213 aatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
     ||||||||||||||||||||||||||||||||    ||||||||||||||||||||| ||||| || ||||||||| ||  ||| |||||||||||    
T  38453969 gatggtgatgtttttgatggttgttggtcaaatagacttgtacatggatatggagtttatagatctgtaaatggggatgttaacactggaaattgga 38453873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 209 - 301
Target Start/End: Complemental strand, 38453697 - 38453605
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattgg 301  Q
    ||||||||||||||||||||||||||||||||||||||   || ||||||||| |||||||| |||||||||||||||||| ||| |||||||    
T  38453697 ggctaatggtgatgtttttgatggttgttggtcaaatggacttatacatggatctggagtttttagatttgcaaatggggatgtcgacattgg 38453605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 155 - 296
Target Start/End: Complemental strand, 34544913 - 34544772
Alignment:
Q  155 ctacattggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgta 254  Q
    ||||||||| |||||||||||||||||||  |||||||||||||||  || || || |||||||||||||||  |||| |||||||||||||    |  |    
T  34544913 ctacattggtaattggaaaaatgataaaatggatggaagagggattatgaattgggttaatggtgatgttttcaatggatgttggtcaaatggacataga 34544814  T
Q  255 catggatatggagtttctagatttgcaaatggggacgtctac 296  Q
    |||||||||||||||| ||||||| |||||||| | ||||||    
T  34544813 catggatatggagtttatagattttcaaatgggaatgtctac 34544772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 209 - 309
Target Start/End: Original strand, 39848639 - 39848739
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    ||||||||||||||||||||||||||||  ||||||||   ||  |||||||| |||||||| |||||||||||||||||| |||||||| |||||||||    
T  39848639 ggctaatggtgatgtttttgatggttgtatgtcaaatggacttagacatggatttggagtttatagatttgcaaatggggatgtctacatcggaaattgg 39848738  T
Q  309 a 309  Q
    |    
T  39848739 a 39848739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 209 - 309
Target Start/End: Complemental strand, 34533809 - 34533709
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    ||||||||||| |||||| |||||||||||||||||||   ||  ||||||||||||||||| ||||||| |||||||||| ||| ||| |||| |||||    
T  34533809 ggctaatggtgttgttttcgatggttgttggtcaaatggacttagacatggatatggagtttgtagatttacaaatggggatgtccacagtggacattgg 34533710  T
Q  309 a 309  Q
    |    
T  34533709 a 34533709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 209 - 309
Target Start/End: Original strand, 38632787 - 38632887
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    ||||| ||||||||| || ||||||||||||||| |||   || ||||||||| |||||||| ||||| |||||||||||| ||||||| ||||||||||    
T  38632787 ggctactggtgatgtcttcgatggttgttggtcagatggacttatacatggatttggagtttatagatctgcaaatggggatgtctacactggaaattgg 38632886  T
Q  309 a 309  Q
    |    
T  38632887 a 38632887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 309
Target Start/End: Complemental strand, 34533994 - 34533847
Alignment:
Q  162 ggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggat 261  Q
    ||||||||| ||||||  |||| |||||| | |||||||  || || || | ||||||||||||||||||||||||||||||||    ||  | ||||||    
T  34533994 ggaaattgggaaaatgggaaaatagatgggaaagggattatgaattgggttgatggtgatgtttttgatggttgttggtcaaatagacttaaagatggat 34533895  T
Q  262 atggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    ||||||||| ||||| |||||||||||| ||| ||| |||| ||||||    
T  34533894 atggagtttatagatatgcaaatggggatgtccacactggacattgga 34533847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 214 - 301
Target Start/End: Complemental strand, 34549262 - 34549175
Alignment:
Q  214 atggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattgg 301  Q
    |||||||||||||||||||||||||||| ||||   ||  ||||||||||||||||| ||||||| |||||||| | |||||||||||    
T  34549262 atggtgatgtttttgatggttgttggtctaatggacttacacatggatatggagtttatagattttcaaatgggaatgtctacattgg 34549175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 162 - 289
Target Start/End: Original strand, 38633019 - 38633145
Alignment:
Q  162 ggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggat 261  Q
    |||||||||||||| || ||||  ||||||| |||||||  ||||| ||||| ||||||||| || |||||||||||||||||||   || |||||||||    
T  38633019 ggaaattggaaaaa-gacaaaatggatggaatagggattatgacttgggctactggtgatgtcttcgatggttgttggtcaaatgggcttatacatggat 38633117  T
Q  262 atggagtttctagatttgcaaatgggga 289  Q
     |||||||| ||||| ||| ||||||||    
T  38633118 ctggagtttatagatatgctaatgggga 38633145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 161 - 289
Target Start/End: Complemental strand, 34539158 - 34539030
Alignment:
Q  161 tggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatgga 260  Q
    |||||||||||||||    |||| ||||||||  ||||||  || || ||||||||| ||||||||| ||||||||||||||||||   ||  ||||||     
T  34539158 tggaaattggaaaaaaaggaaaagagatggaaatgggattatgaattgggctaatggcgatgtttttaatggttgttggtcaaatggacttagacatggt 34539059  T
Q  261 tatggagtttctagatttgcaaatgggga 289  Q
    | |||||||| ||||||||||||||||||    
T  34539058 tctggagtttatagatttgcaaatgggga 34539030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 212 - 308
Target Start/End: Complemental strand, 34916645 - 34916549
Alignment:
Q  212 taatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    |||||||| | |||| |||||||||||||||||||   ||  ||||||||||||||||| ||||| |||||||||  ||||||||| ||||||||||    
T  34916645 taatggtgctattttcgatggttgttggtcaaatggactttcacatggatatggagtttatagatctgcaaatggaaacgtctacactggaaattgg 34916549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 229 - 309
Target Start/End: Original strand, 39848518 - 39848598
Alignment:
Q  229 atggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    ||||||||||||||||||   ||| ||||||||||||||||| |||||  ||||||||||| |||| ||||||||||||||    
T  39848518 atggttgttggtcaaatggacttgcacatggatatggagtttatagatccgcaaatggggatgtctccattggaaattgga 39848598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 289
Target Start/End: Original strand, 39848723 - 39848857
Alignment:
Q  155 ctacattggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgta 254  Q
    |||||| |||||||||||||| || ||||  ||||||| |||||||  || || || |  ||||||||| || |||||||||||||||||||   || ||    
T  39848723 ctacatcggaaattggaaaaaagacaaaatggatggaacagggattatgagttgggttgttggtgatgtcttcgatggttgttggtcaaatggacttata 39848822  T
Q  255 catggatatggagtttctagatttgcaaatgggga 289  Q
    |||||||||||||||| ||||| ||| || |||||    
T  39848823 catggatatggagtttatagatatgctaacgggga 39848857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 309
Target Start/End: Complemental strand, 34916234 - 34916134
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    |||||| ||||||||||| ||||||| |||||||||||       |||||| |||||||||| ||||||||||||||| || ||||||| ||||||||||    
T  34916234 ggctaacggtgatgttttcgatggttattggtcaaatggacagaaacatggctatggagtttatagatttgcaaatggagatgtctacactggaaattgg 34916135  T
Q  309 a 309  Q
    |    
T  34916134 a 34916134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 181 - 308
Target Start/End: Complemental strand, 34916400 - 34916273
Alignment:
Q  181 aaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgc 280  Q
    |||| ||||||| |||||||  || || || |||||||| | |||| ||||||| |||||||||||   ||  ||||||||||||||||| ||||| |||    
T  34916400 aaaaggatggaaaagggattatgaattggggtaatggtgctattttcgatggttattggtcaaatggactttcacatggatatggagtttatagatctgc 34916301  T
Q  281 aaatggggacgtctacattggaaattgg 308  Q
     |||||  ||||||||| ||||||||||    
T  34916300 taatggaaacgtctacactggaaattgg 34916273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 209 - 308
Target Start/End: Complemental strand, 34916510 - 34916411
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    |||||| | ||||||||| ||||||| |||||||||||    |  ||||||||||||||||| |||||||||||||||||| |||||   ||||||||||    
T  34916510 ggctaacgatgatgttttcgatggttattggtcaaatggacataaacatggatatggagtttatagatttgcaaatggggatgtctatgctggaaattgg 34916411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 209 - 309
Target Start/End: Original strand, 38632651 - 38632751
Alignment:
Q  209 ggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgg 308  Q
    |||| ||||||||| |||||||||||||   |||||||  |||  |||||||| |||||||| ||||| |||| ||||| | |||||||| |||||||||    
T  38632651 ggctgatggtgatgcttttgatggttgtctatcaaatggatttagacatggatttggagtttatagatatgcagatgggcatgtctacatgggaaattgg 38632750  T
Q  309 a 309  Q
    |    
T  38632751 a 38632751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 210 - 309
Target Start/End: Original strand, 38632929 - 38633028
Alignment:
Q  210 gctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    ||||| ||||||||||||||||||| || ||||||||   ||  | |||||| |||||||| || ||||||||||||||| || ||| | ||||||||||    
T  38632929 gctaacggtgatgtttttgatggttatttgtcaaatggacttagatatggatttggagtttataaatttgcaaatggggatgtttacgtaggaaattgga 38633028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 216 - 309
Target Start/End: Complemental strand, 34533664 - 34533571
Alignment:
Q  216 ggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    ||||||||||| ||||||||||||| |||||   ||  |||||||| |||||||| || || ||| |||||||| ||||| |||||||| ||||    
T  34533664 ggtgatgttttcgatggttgttggtaaaatggacttaaacatggatctggagtttatacatatgctaatggggatgtctatattggaaaatgga 34533571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 309
Target Start/End: Complemental strand, 34544939 - 34544897
Alignment:
Q  267 gtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    |||| |||||||||||||||||| ||||||||||| |||||||    
T  34544939 gtttatagatttgcaaatggggatgtctacattggtaattgga 34544897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 200
Target Start/End: Complemental strand, 34916150 - 34916105
Alignment:
Q  155 ctacattggaaattggaaaaatgataaaaaagatggaagagggatt 200  Q
    ||||| |||||||||||||||| ||||||  |||||||||||||||    
T  34916150 ctacactggaaattggaaaaataataaaatggatggaagagggatt 34916105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 217 - 285
Target Start/End: Original strand, 39848368 - 39848436
Alignment:
Q  217 gtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatg 285  Q
    |||||||||||||||||||| | |||| ||   || ||||||||| |||||||| ||||| ||||||||    
T  39848368 gtgatgtttttgatggttgtcgatcaattgcgcttatacatggatttggagtttatagatatgcaaatg 39848436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 13 - 309
Target Start/End: Original strand, 44474168 - 44474467
Alignment:
Q  13 caatatatgtgggtgattgggttgatggagataagacagggaaaggac---tgttcatacagccatcaggagacaagtatgagggtgaattctttgggaa 109  Q
    ||||||||| ||||||||  ||||||||| |   | ||||||||||||   ||||  |||||||||||| |   ||||||||||| || |||| ||||||    
T  44474168 caatatatgagggtgattttgttgatggaaaggtggcagggaaaggacgactgttggtacagccatcagcatcaaagtatgagggcgacttctctgggaa 44474267  T
Q  110 ttgccgtcatggcaatggcacccaaacttataagaatggaggtagctacattggaaattggaaaaatgataaaaaagatggaagagggattgagactttg 209  Q
    || ||||||||| |||||||||| |||||  ||| |||||  || ||||||||||||||||||||| |||| |  ||||||||||||||||   |||| |    
T  44474268 tttccgtcatggtaatggcaccctaactttgaaggatggaactatctacattggaaattggaaaaaagatacaccagatggaagagggattttcacttgg 44474367  T
Q  210 gctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattggaaattgga 309  Q
    |||| ||| |||||||||  ||||| |||||||||||   |||||||||||| |||||||| || || |  | ||||||| ||||||  |||||||||||    
T  44474368 gctattggcgatgtttttattggttcttggtcaaatggccttgtacatggatttggagtttttacatctctagatggggatgtctacgctggaaattgga 44474467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 162 - 301
Target Start/End: Original strand, 44474596 - 44474735
Alignment:
Q  162 ggaaattggaaaaatgataaaaaagatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggat 261  Q
    ||||||||||||||||| ||||  |||||||||||||    || || | ||||||||||||||||||| ||||| ||||||||||   || |||||||||    
T  44474596 ggaaattggaaaaatgacaaaatggatggaagagggaccatgagttggactaatggtgatgtttttgaaggttgctggtcaaatggacttatacatggat 44474695  T
Q  262 atggagtttctagatttgcaaatggggacgtctacattgg 301  Q
     |||||||| || ||||||||||||||| ||| |||||||    
T  44474696 ctggagtttttaaatttgcaaatggggatgtcgacattgg 44474735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 186 - 309
Target Start/End: Original strand, 44474482 - 44474605
Alignment:
Q  186 gatggaagagggattgagactttggctaatggtgatgtttttgatggttgttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatg 285  Q
    ||||||||||||| |  || || |||||||| ||||  |||| ||||||||  ||||||||   ||  |||||||| |||||||| || ||||| |||||    
T  44474482 gatggaagagggaatttgaattgggctaatgatgatcattttaatggttgtctgtcaaatgggcttagacatggatttggagtttatacatttgtaaatg 44474581  T
Q  286 gggacgtctacattggaaattgga 309  Q
    |||| ||||| || ||||||||||    
T  44474582 gggatgtctatatcggaaattgga 44474605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 121
Target Start/End: Original strand, 32716505 - 32716614
Alignment:
Q  12 acaatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaag-tatgagggtgaattctttgggaat 110  Q
    |||||||||| ||||||||||||||||||| | | |||||||||||| | | ||||| | |||||||||| |||| | ||||||| |||||||| |||||    
T  32716505 acaatatatgagggtgattgggttgatggaaaaaggacagggaaagggcggatcatatatccatcaggag-caagttttgagggtcaattctttaggaat 32716603  T
Q  111 tgccgtcatgg 121  Q
    | |||||||||    
T  32716604 tcccgtcatgg 32716614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 12 - 121
Target Start/End: Original strand, 32716712 - 32716821
Alignment:
Q  12 acaatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaag-tatgagggtgaattctttgggaat 110  Q
    |||||||||| ||||||||||||||||||| | | |||||||||||| | | ||||| | |||||||||| |||| | ||||||| |||||||| |||||    
T  32716712 acaatatatgagggtgattgggttgatggaaaaaggacagggaaagggcggatcatatatccatcaggag-caagttttgagggtcaattctttaggaat 32716810  T
Q  111 tgccgtcatgg 121  Q
    | |||||||||    
T  32716811 tcccgtcatgg 32716821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 12 - 81
Target Start/End: Original strand, 32714091 - 32714160
Alignment:
Q  12 acaatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggag 81  Q
    |||||||||| ||||||||||||||||||| | | |||||||||||| | | ||||| | ||||||||||    
T  32714091 acaatatatgagggtgattgggttgatggaaaaaggacagggaaagggcggatcatatatccatcaggag 32714160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 12 - 111
Target Start/End: Original strand, 32717333 - 32717432
Alignment:
Q  12 acaatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaag-tatgagggtgaattctttgggaat 110  Q
    |||||||| | |||||||||||||||||||   | |||||||||||||| | | ||| | |||||||||| |||| | |||||||||||||| | |||||    
T  32717333 acaatatacgagggtgattgggttgatggaagaaggacagggaaaggacggataatatatccatcaggag-caagttttgagggtgaattctctaggaat 32717431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 87 - 227
Target Start/End: Complemental strand, 7046295 - 7046154
Alignment:
Q  87 tatgagggtgaattctttgggaattg-ccgtcatggcaatggcacccaaacttataagaatggaggtagctacattggaaattggaaaaatgataaaaaa 185  Q
    |||||||||||||||| | ||||||  ||||||||| || |||||||| ||||  ||  |||||  |  |||| |||||||||||||||| |||||||      
T  7046295 tatgagggtgaattctctaggaatttaccgtcatggtaagggcacccagacttggaaagatggaaatgactacgttggaaattggaaaaaagataaaatg 7046196  T
Q  186 gatggaagagggattgagactttggctaatggtgatgttttt 227  Q
    ||||||| |||||||| || || ||||||||||||| |||||    
T  7046195 gatggaaaagggattgtgagttgggctaatggtgattttttt 7046154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 7046930 - 7046868
Alignment:
Q  13 caatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccat 75  Q
    ||||||||| ||| |||||| ||||||| || | |||||||||||||  ||||||||||||||    
T  7046930 caatatatgagggagattggattgatggggagatgacagggaaaggatggttcatacagccat 7046868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 301
Target Start/End: Complemental strand, 7045879 - 7045814
Alignment:
Q  236 ttggtcaaatgattttgtacatggatatggagtttctagatttgcaaatggggacgtctacattgg 301  Q
    |||||||||||   || |||||||||||||||||| || |||||||||||| || ||| |||||||    
T  7045879 ttggtcaaatggacttatacatggatatggagtttttacatttgcaaatggagatgtcaacattgg 7045814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 12 - 102
Target Start/End: Original strand, 2998222 - 2998312
Alignment:
Q  12 acaatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaag-tatgagggtgaattct 102  Q
    |||||||||| ||||||||||||||||| | | | |||||||||||||| | ||||| | ||||||||| ||||| | ||||||||||||||    
T  2998222 acaatatatgagggtgattgggttgatgaacaaaggacagggaaaggacggatcatatatccatcagga-acaagttttgagggtgaattct 2998312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 15 - 121
Target Start/End: Complemental strand, 14905626 - 14905520
Alignment:
Q  15 atatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaagtat-gagggtgaattctttgggaattgc 113  Q
    ||||||| |||||| |||||||| ||||| | ||| |||||||| | | | ||| | |||||||||| ||||| | ||||||||||||||| |||||| |    
T  14905626 atatatgagggtgactgggttgacggagaaaggactgggaaagggcggatgatatatccatcaggag-caagttttgagggtgaattctttaggaattcc 14905528  T
Q  114 cgtcatgg 121  Q
    ||||||||    
T  14905527 cgtcatgg 14905520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 14 - 104
Target Start/End: Complemental strand, 14905006 - 14904916
Alignment:
Q  14 aatatatgtgggtgattgggttgatggagataagacagggaaaggactgttcatacagccatcaggagacaagtatgagggtgaattcttt 104  Q
    |||||||| |||||| |||||||||||| | |||||||||||||| | | | |||   ||||||||||| |  | ||||||||||||||||    
T  14905006 aatatatgagggtgactgggttgatggaaaaaagacagggaaagggcggatgatatttccatcaggagaaagttttgagggtgaattcttt 14904916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University