View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_high_14 (Length: 315)
Name: NF8551_high_14
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 3e-20; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 32 - 110
Target Start/End: Original strand, 42577802 - 42577880
Alignment:
| Q |
32 |
aaggaaaaggaggatacactgcctaaaaagattatggtgagtttagttccttgaactgcttgtttatgctatgatactc |
110 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||| || ||||| ||||||||| |||| ||||| |
|
|
| T |
42577802 |
aaggaaaagaacgatacactgcctaaaaagattatggtgagtttagttcatttaactggttgtttatgttatgctactc |
42577880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 32 - 110
Target Start/End: Original strand, 42570616 - 42570694
Alignment:
| Q |
32 |
aaggaaaaggaggatacactgcctaaaaagattatggtgagtttagttccttgaactgcttgtttatgctatgatactc |
110 |
Q |
| |
|
||||||||| | |||||||||||||| || ||||||||||||||||| |||| ||||| |||||||||||||| ||||| |
|
|
| T |
42570616 |
aaggaaaagaacgatacactgcctaagaaaattatggtgagtttagtacctttaactggttgtttatgctatgttactc |
42570694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 59 - 110
Target Start/End: Original strand, 42573015 - 42573066
Alignment:
| Q |
59 |
aagattatggtgagtttagttccttgaactgcttgtttatgctatgatactc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
42573015 |
aagattatggtgagtttagttccttgaactggttgtttgtgctatgctactc |
42573066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 241 - 297
Target Start/End: Original strand, 42594573 - 42594629
Alignment:
| Q |
241 |
gttcattctctttatggaagcatttggatagttctgttttaaggcctaaattaaaat |
297 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||| || |||||||| |
|
|
| T |
42594573 |
gttcattctttttatggaagcatttagatacttctgttttaaggcgtacattaaaat |
42594629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 42594494 - 42594563
Alignment:
| Q |
35 |
gaaaaggaggatacactgcctaaaaagattatggtgagtttagttccttgaactgcttgtttatgctatg |
104 |
Q |
| |
|
||||||||| ||| ||||||||||| || ||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
42594494 |
gaaaaggagaatattctgcctaaaaacgttgtggtgagtttagttccttgaattggttgtttatactatg |
42594563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University