View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_high_18 (Length: 246)
Name: NF8551_high_18
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 24069330 - 24069539
Alignment:
| Q |
19 |
gaacaacatgaacgctaatataacaaagaacgttgcaagaagataagcataaagagcctcgttgatacggaacatcgagcccattattccgagaacggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24069330 |
gaacaacatgaacgctaatataacaaagaacgttgcaagaagataagcataaagagcctcgttgatacggaacatcgagcccattattccgagaacagat |
24069429 |
T |
 |
| Q |
119 |
acaacgaaaacaaagaaggcgccgaagaggagaggatacatcaacactttaaggcagtcggttttgtggaagtgaatgtatgcagaaccagccatgccag |
218 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
24069430 |
acgacgaaaacaaagaaggccccgaagaggagaggatacatcaacactttaaggcagtctgttttatggaagtggatgtatgcagaaccagccatgccag |
24069529 |
T |
 |
| Q |
219 |
cgagtgaaag |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
24069530 |
cgagtgaaag |
24069539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University