View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_high_23 (Length: 229)
Name: NF8551_high_23
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_high_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 38014700 - 38014509
Alignment:
| Q |
20 |
tcaaacctgcttgcttccctgtttatgtttttatttgctttgtttgcagcttgagaaaggagagaatttcgttgatgtgcttaacccttgcacaaaaaag |
119 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
38014700 |
tcaaacctgcttgcttccctgtttaagtttatatttgctttgtttgcagcttgaggaaggagaggatttcactgatgtgcttaacccttgcacaaaaaag |
38014601 |
T |
|
| Q |
120 |
gagactctagcatatggagactccaatatgcaaaatcttaagcgtggagaagtattacagctggagagaaagggatatttcaggtgtgatgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38014600 |
gagactctagcatatggagactccaatatgcgaaatcttaagcgtggagaagtattgcagctggagagaaagggatattttaggtgtgatgt |
38014509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University