View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_high_24 (Length: 218)
Name: NF8551_high_24
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 9978630 - 9978445
Alignment:
| Q |
18 |
caatgtacaattcttcttcttctttcaagctttttcgttcattgatttccgatggttgatgcgatgaaattgaatgtgaattgatgattgtagatgtgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9978630 |
caatgtacaattcttcttcttctttcaagctttttcgttcattgatttccgatggttgatgcgatgaaattgaatgtgaattgatgattgtagatgtgaa |
9978531 |
T |
 |
| Q |
118 |
gaaagcttccaagcgaaatgtggaggagatattggaggaggatcatctcttctcgctcgatgtaagta-ttttcgcgccttttcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9978530 |
gaaagcttccaagcgaaatgtggaggagatattggaggaggatcatctcttctcgctcgatgtaagtatttttcgcgccttttcat |
9978445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University