View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_high_27 (Length: 216)
Name: NF8551_high_27
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_high_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 29 - 199
Target Start/End: Original strand, 15448525 - 15448695
Alignment:
| Q |
29 |
gcttttgaaaatcatcacgaaccattgtcaaatcttcttgtgtaagaaatatatcacgaatcttcttaggagtttttcctttaaatttcaaagaaagtgc |
128 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15448525 |
gcttttgacaatcatcacgaaccattgttagatcttcttgtgtaagaaatatatcacgaatcttcttaggagtttttcctttaaatttcaaagaaagtgc |
15448624 |
T |
 |
| Q |
129 |
atcacaagatagatgaagcaaatgatcaagttgaagcctagcagcaacaactgctatcccacacaacgtct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15448625 |
atcacaagatagatgaagcaaatgatcaagttgaagcctagcagcaaccactgctatcccacacaacgtct |
15448695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 199
Target Start/End: Original strand, 12099005 - 12099068
Alignment:
| Q |
136 |
gatagatgaagcaaatgatcaagttgaagcctagcagcaacaactgctatcccacacaacgtct |
199 |
Q |
| |
|
||||||| | ||||||||| |||||||||| | ||| |||||||||| | |||||||||||||| |
|
|
| T |
12099005 |
gatagattatgcaaatgattaagttgaagcttcgcatcaacaactgcaaacccacacaacgtct |
12099068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 146 - 199
Target Start/End: Complemental strand, 12849310 - 12849257
Alignment:
| Q |
146 |
gcaaatgatcaagttgaagcctagcagcaacaactgctatcccacacaacgtct |
199 |
Q |
| |
|
||||||||| |||||||||| | ||| |||||||||| | |||||||||||||| |
|
|
| T |
12849310 |
gcaaatgattaagttgaagcttcgcatcaacaactgcaaacccacacaacgtct |
12849257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University