View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_24 (Length: 288)
Name: NF8551_low_24
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_24 |
 | |
|
| [»] scaffold0743 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 38 - 269
Target Start/End: Complemental strand, 17945119 - 17944888
Alignment:
| Q |
38 |
attctttcagtttcctttcattcgtgaaagctatagtgtcttaatttgatggagtcatcatttccttaggaattataatattcactgaattaaatatcaa |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17945119 |
attcttttagtttcctttcattcgtgaaagctatagtgtcttaatttgatggagtcatcatttccttaggaattatagtattcactgaattaaatatcaa |
17945020 |
T |
|
| Q |
138 |
atttatcttcaatgttttgtaggcacctcattttcagtaattgtcttcaagtttttgattcatatctgcaaattgcacttcttgctctttgcctctaaat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17945019 |
atttatcttcaatgttttgtaggcacctcattttcagtaattgtcttcaagtttttgattcatatttgcaaattgcacttcttgctctttgcctctaaat |
17944920 |
T |
|
| Q |
238 |
ccccttatgcatgcaaacttcagctttagatc |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17944919 |
ccccttatgcatgcaaacttcagctttagatc |
17944888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0743 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0743
Description:
Target: scaffold0743; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 204 - 269
Target Start/End: Original strand, 4085 - 4150
Alignment:
| Q |
204 |
tgcaaattgcacttcttgctctttgcctctaaatccccttatgcatgcaaacttcagctttagatc |
269 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
4085 |
tgcaaattgcacttctttctctttgcctctaaatccccttatacatacaaacttcagcttttgatc |
4150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University