View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_26 (Length: 255)
Name: NF8551_low_26
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 21 - 126
Target Start/End: Original strand, 36588325 - 36588430
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaatgtacatgcggcatacagatggca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
36588325 |
aaaatggtccctggacccacttttttgctgatttatcacatttttacttatgtgttagttgctgactatgcaaaaatgtacatgtggcatacaaatggca |
36588424 |
T |
 |
| Q |
121 |
attgcc |
126 |
Q |
| |
|
|||||| |
|
|
| T |
36588425 |
attgcc |
36588430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 36589343 - 36589274
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| | || | | || ||| ||||||||||||||| |
|
|
| T |
36589343 |
aaaatggtccctaaacccacttttttgctgatttgtcacaattctgcctacgtggcagttgctgactgtg |
36589274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 21 - 126
Target Start/End: Original strand, 3936681 - 3936786
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaatgtacatgcggcatacagatggca |
120 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
3936681 |
aaaatggttcctggacccacttttttgctgatttatcacatttttacttatgtgttagttgctgactatgcaaaaatgtacatgtggcatacaaatggca |
3936780 |
T |
 |
| Q |
121 |
attgcc |
126 |
Q |
| |
|
|||||| |
|
|
| T |
3936781 |
attgcc |
3936786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 3938017 - 3937948
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||| |||| | | || ||| || |||||||||||| |
|
|
| T |
3938017 |
aaaatggtccctagacccacttttttgctgatttgtcacatttctgcctacgtggcaattgctgactgtg |
3937948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 21 - 126
Target Start/End: Original strand, 45618387 - 45618492
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaatgtacatgcggcatacagatggca |
120 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||||||||| | |||||| |||||| |
|
|
| T |
45618387 |
aaaacggtccttggacccacttttttgctgatttatcacatttttacttatgtgtcagctgctgactatgcaaaaatgtacatgtgacatacaaatggca |
45618486 |
T |
 |
| Q |
121 |
attgcc |
126 |
Q |
| |
|
|||||| |
|
|
| T |
45618487 |
attgcc |
45618492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 90
Target Start/End: Complemental strand, 45619686 - 45619618
Alignment:
| Q |
22 |
aaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||| | | || ||| ||||||||||||||| |
|
|
| T |
45619686 |
aaatggtccctagacccacttttttgctgatttatcacatttctgcctacgtggcagttgctgactgtg |
45619618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 32699270 - 32699201
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
||||| |||||| | ||||||||||||||||||| ||| |||| ||| || |||||||||||||| |||| |
|
|
| T |
32699270 |
aaaatagtccctaggcccacttttttgctgatttgtcacatttctacctacgtgtcagttgctgattgtg |
32699201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 37 - 96
Target Start/End: Original strand, 32698112 - 32698171
Alignment:
| Q |
37 |
ccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaa |
96 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
32698112 |
ccacttttttgctgatttgtcacatttttgcttatgtggtccttgctgactgtgcaaaaa |
32698171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 35911844 - 35911742
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaatgtacatgcggcatacagatggca |
120 |
Q |
| |
|
|||||||||||||| |||||||||| | |||||| ||| |||| | | || || ||| ||||||| ||||||| ||||||||| ||||| ||| ||||| |
|
|
| T |
35911844 |
aaaatggtccctggtcccactttttcgatgatttgtcacatttatgcatacttggcagatgctgacggtgcaaacatgtacatgtggcatccaggtggca |
35911745 |
T |
 |
| Q |
121 |
att |
123 |
Q |
| |
|
||| |
|
|
| T |
35911744 |
att |
35911742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 1171593 - 1171540
Alignment:
| Q |
37 |
ccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||| || ||||||||||||||||||| |
|
|
| T |
1171593 |
ccacttttttgctgatttgtcacatttctacctacgtgtcagttgctgactgtg |
1171540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000009; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 37 - 102
Target Start/End: Original strand, 5610276 - 5610341
Alignment:
| Q |
37 |
ccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtgcaaaaatgtaca |
102 |
Q |
| |
|
|||||||||||||||||| ||| |||||| |||||||| | | ||||||||||||||| ||||| |
|
|
| T |
5610276 |
ccacttttttgctgatttgtcacatttttgcttatgtggcccatactgactgtgcaaaaacgtaca |
5610341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 86
Target Start/End: Original strand, 36748300 - 36748365
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgac |
86 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| || |||||| | |||||| ||| ||||||| |
|
|
| T |
36748300 |
aaaatagtctctggacccacttttttgctgatttgtctcatttttgcctatgtggcagatgctgac |
36748365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 42447743 - 42447674
Alignment:
| Q |
21 |
aaaatggtccctggacccacttttttgctgatttatcatatttttacttatgtgtcagttgctgactgtg |
90 |
Q |
| |
|
||||| |||| |||||||||||| |||||||||| || |||||| | |||||| ||| ||||||||||| |
|
|
| T |
42447743 |
aaaatagtccttggacccactttcttgctgatttgtcccatttttgcctatgtgacagatgctgactgtg |
42447674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University