View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8551_low_30 (Length: 246)

Name: NF8551_low_30
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8551_low_30
NF8551_low_30
[»] chr2 (1 HSPs)
chr2 (19-228)||(24069330-24069539)


Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 24069330 - 24069539
Alignment:
19 gaacaacatgaacgctaatataacaaagaacgttgcaagaagataagcataaagagcctcgttgatacggaacatcgagcccattattccgagaacggat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
24069330 gaacaacatgaacgctaatataacaaagaacgttgcaagaagataagcataaagagcctcgttgatacggaacatcgagcccattattccgagaacagat 24069429  T
119 acaacgaaaacaaagaaggcgccgaagaggagaggatacatcaacactttaaggcagtcggttttgtggaagtgaatgtatgcagaaccagccatgccag 218  Q
    || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||    
24069430 acgacgaaaacaaagaaggccccgaagaggagaggatacatcaacactttaaggcagtctgttttatggaagtggatgtatgcagaaccagccatgccag 24069529  T
219 cgagtgaaag 228  Q
    ||||||||||    
24069530 cgagtgaaag 24069539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University