View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_32 (Length: 244)
Name: NF8551_low_32
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_32 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 6611331 - 6611557
Alignment:
| Q |
19 |
agtctttatgtctaggaccatcaaaattgccaaggcttttaaaacccaacctcccctttgcaatttaggtcatacgtccttattttctcctcttccccta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6611331 |
agtctttatgtctaggaccatcaaaattgccaaggcttttaaaacccaacctcccctttgcaatttaggtcatacgtccttattttctcctcttccccta |
6611430 |
T |
 |
| Q |
119 |
caacaatagcataagctgctacagtaagaaagcagaaagaaacttgagcaagaaagaaaaaatgcattgcatat-aatttagtaagtatgcataccgtgc |
217 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6611431 |
caacaatagcataagctgcttcagtaagaaagcagaaagaaacttgagcaagaaagaaagaatgcattgcatataaatttagtaagtatgcataccgtgc |
6611530 |
T |
 |
| Q |
218 |
tagcataatcatccatagttgactgct |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
6611531 |
tagcataatcatccatagttgactgct |
6611557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University