View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_33 (Length: 243)
Name: NF8551_low_33
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 22682500 - 22682282
Alignment:
| Q |
1 |
ctaactcatctaccgagtttcttgatggattaaagtttggtcaaaaaatctaatttgaagatgcaacaagtactgttgttgtagcagcttctcaaaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22682500 |
ctaactcatctaccgagtttcttgatggattaaagtttggtcaaaaaatctactttgaagatgcaacaagtactgttgttgtaccagcttctcaaaccaa |
22682401 |
T |
 |
| Q |
101 |
acctaatgctgttggtgttggtggttcttcttcttcttcatcatcatcttcaggaatgaagagaggaaataatcatccacctaggtgtcaagttgaaggt |
200 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| ||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22682400 |
acctaatgctattggtgttggtggctcttctt---cttcatcttcatcttcaggaatgaagaggggaaataatcatccacctaggtgtcaagttgaaggt |
22682304 |
T |
 |
| Q |
201 |
tgtaaagtagatctgagtggtg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
22682303 |
tgtaaagtagatctgagtggtg |
22682282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 177 - 216
Target Start/End: Complemental strand, 36896903 - 36896864
Alignment:
| Q |
177 |
ccacctaggtgtcaagttgaaggttgtaaagtagatctga |
216 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
36896903 |
ccacctaggtgtcaagttgaaggatgtaaactagatctga |
36896864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University