View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_35 (Length: 242)
Name: NF8551_low_35
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 55 - 224
Target Start/End: Complemental strand, 8324249 - 8324080
Alignment:
| Q |
55 |
tagttagattttacttatattttttaccactaactatgagttctttttggtttatattttgaggggaaaatgatcattttcttatttgtttgcaatttac |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8324249 |
tagttagattttacttatattttttaccactaactatgagttctttttggtttatattttgaggggaaaatgatcattttcttatttgttggcaatttac |
8324150 |
T |
 |
| Q |
155 |
ttgaagcgtttcttatctgatgcaaaattggtttataactggtgttttttgtttgtggtagtgcaacact |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8324149 |
ttgaagcgtttcttatctgatgcaaaattggtttataactgatgttttttgtttgtggtagtgcaacact |
8324080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 8324274 - 8324236
Alignment:
| Q |
1 |
ataatgacatttaataaaatgaagatagttagattttac |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8324274 |
ataatgacatttaataaaatgaagatagttagattttac |
8324236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University