View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_36 (Length: 241)
Name: NF8551_low_36
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_36 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 408525 - 408747
Alignment:
| Q |
19 |
atttggaattgttgcaatgattcaaatctgtttagctggatttcgcaaagtactcactaagtgtagtagttagaaattaggaagcagtgttcacagatgt |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408525 |
atttggaattgttgcaatggttcaaatctgtttagctggatttcgcaaagtactcactaagtgtagtagttagaaattaggaagcagtgttcacagatgt |
408624 |
T |
|
| Q |
119 |
gtgatcagattaagagggccagcaaattttgggaaatttggatgaaaaccagtgtcacacttgccttcatcttgtaacttcttaatgatactttataact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
408625 |
gtgatcagattaagagggccagcaaattttgggaaatttggatgaaaaccagtgtcacacttgccttcatcttgtaacttcttaatgatactttataact |
408724 |
T |
|
| Q |
219 |
ttttatgtaatagacgtaaattt |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
408725 |
ttttatgtaatagacgtaaattt |
408747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University