View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8551_low_43 (Length: 218)

Name: NF8551_low_43
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8551_low_43
NF8551_low_43
[»] chr8 (1 HSPs)
chr8 (18-202)||(9978445-9978630)


Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 202
Target Start/End: Complemental strand, 9978630 - 9978445
Alignment:
18 caatgtacaattcttcttcttctttcaagctttttcgttcattgatttccgatggttgatgcgatgaaattgaatgtgaattgatgattgtagatgtgaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9978630 caatgtacaattcttcttcttctttcaagctttttcgttcattgatttccgatggttgatgcgatgaaattgaatgtgaattgatgattgtagatgtgaa 9978531  T
118 gaaagcttccaagcgaaatgtggaggagatattggaggaggatcatctcttctcgctcgatgtaagta-ttttcgcgccttttcat 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
9978530 gaaagcttccaagcgaaatgtggaggagatattggaggaggatcatctcttctcgctcgatgtaagtatttttcgcgccttttcat 9978445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University